•

Journal Archive

Korean Journal of Medicinal Crop Science - Vol. 31 , No. 5
[Paper List] [Go to Volume List]

[ Article ]
Korean Journal of Medicinal Crop Science - Vol. 31, No. 5, pp.304-315
Abbreviation: Korean J. Medicinal Crop Sci
ISSN: 1225-9306 (Print) 2288-0186 (Online)
Print publication date 31 Oct 2023
Received 02 Aug 2023 Revised 19 Oct 2023 Accepted 19 Oct 2023
DOI: https://doi.org/10.7783/KJMCS.2023.31.5.304

단삼 유전체 염기서열을 이용한 Genomic Simple Sequence Repeats Marker 개발 및 품종 구분
김이현1, 2 ㆍ 마경호3 ㆍ 이정훈4 ㆍ 정진태5 ㆍ 한종원6, ‡ ㆍ 정종욱7, †
1농촌진흥청 국립원예특작과학원 인삼특작부 약용작물과 연구원
2충북대학교 농업생명환경대학 특용식물학과 석사과정생
3농촌진흥청 국립원예특작과학원 인삼특작부 약용작물과 연구관
4농촌진흥청 국립원예특작과학원 인삼특작부 약용작물과 연구사
5농촌진흥청 국립원예특작과학원 인삼특작부 약용작물과 연구사
6농촌진흥청 국립원예특작과학원 인삼특작부 약용작물과 연구사
7충북대학교 농업생명환경대학 특용식물학과 부교수

Development of Genomic Simple Sequence Repeat Markers and Variety Discrimination in Salvia miltiorrhiza Bunge
Kim Ei Hyun1, 2 ㆍ Ma Kyung Ho3 ㆍ Lee Jeong Hoon4 ㆍ Jeong Jin Tae5 ㆍ Han Jong Won6, ‡ ㆍ Chung Jong Wook7, †
1Researcher, Department of Herbal Crop Reseach, NIHHS, RDA, Korea
2Master’s stdunt, Department of Industrial Plant Science and Technology, Chungbuk National University, Cheongju 28644, Korea
3Researcher, Department of Herbal Crop Reseach, NIHHS, RDA, Korea
4Researcher, Department of Herbal Crop Reseach, NIHHS, RDA, Korea
5Researcher, Department of Herbal Crop Reseach, NIHHS, RDA, Korea
6Researcher, Department of Herbal Crop Reseach, NIHHS, RDA, Korea
7Associate professor, Department of Industrial Plant Science and Technology, Chungbuk National University, Cheongju 28644, Korea
Correspondence to : †(Phone) +82-43-261-2524 (E-mail) jwchung73@chungbuk.ac.kr

Co-corresponding author: ‡(Phone) +82-43-871-5673 (E-mail) (pvphan@korea.kr)




This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Funding Information ▼
ABSTRACT
Background

Salvia miltiorrhiza Bunge, of the Lamiaceae family, is a medicinal plant. This study aimed to develop polymorphic simple sequence repeat (SSR) markers for analyzing the genetic diversity and distinguishing between varieties of S. miltiorrhiza.

Methods and Results

Using whole genome resequencing data, 50 SSR markers were designed for S. miltiorrhiza. Of these, 41 polymorphic markers were selected and utilized to assess 44 S. miltiorrhiza accessions. A total of 346 alleles were detected (2 to 17 per locus, averaging 8.4). Major allele frequency ranged from 0.19 to 0.83 (average 0.47), observed heterozygosity ranged from 0 to 0.60 (average 0.22), and polymorphic information content ranged from 0.29 to 0.87 (average 0.64). Among the 41 SSR markers, 18 were effective for distinguishing varieties, particularly S. miltiorrhiza ‘Dasan’, ‘Gosan’, and 'Hongdan' varieties.

Conclusions

The SSR markers developed in this study could be effectively used for variety discrimination, genetic diversity analysis, and population genetics studies for breeding in S. miltiorrhiza.

KeyWords: Salvia miltiorrhiza Bunge, Genetic Diversity, Simple Sequence Repeats Marker Development, Variety Discrimination
서 언

단삼 (Salvia miltiorrhiza Bunge)은 꿀풀과 샐비어속의 다년생 약용작물로 원산지는 중국이며 한국, 일본, 몽골, 베트남, 호주 등에 분포한다 (Lu, 2019). Salvia 속은 전세계적으로 약 1,000 여 종이 분포하고 있으며, 우리나라에서는 S. miltiorrhiza가 대한민국약전 (KP)에 단삼으로 등재되어 사용되고 있다(Will and Claßen-Bockhoff, 2017; MFDS, 2020).

단삼은 항산화, 항염, 항암, 항노화 등의 효능이 있으며, 심혈관 질환, 뇌혈관 질환, 알츠하이머 등에 효과가 있다고 보고되었다 (Su et al., 2015; Zhang et al., 2016). 단삼의 국내 재배 및 생산량은 2019년 8 톤에서 2021년 66 톤으로 약 8배 증가하였으나, 중국에서의 수입 의존도는 여전히 높다(MAFRA, 2020; 2022).

생물다양성 협약 (Convention on Biological Diversity, CBD) 채택 및 나고야의정서 (Nagoya protocol) 발효로 자국 자원보호 기반 구축 및 유전자원 주권 확보의 중요성이 커지고 있다 (Buck and Hamilton, 2011). 국제식물신품종보호동맹 (International Union for the Protection of New Varieties of Plants, UPOV)에서는 육종가의 권리와 품종 지적 재산권 보호를 위한 국제 규범을 관리하고 있으며, 더불어 품종 구분 기술 필요성이 증가하고 있다 (Choi, 2002; Chung et al., 2009; Choi and Kim, 2010).

품종 구분은 형태적, 생화학적, 분자적 특성을 통해 평가할 수 있으며, 분자마커의 경우 생육 시기 및 환경에 영향을 받지 않아 형태적, 생화학적 평가의 한계점을 보완할 수 있다 (Chen and Nelson, 2004; Smýkal et al., 2008; Parida et al., 2009). UPOV 산하 기술위원회 중 분자생물학 및 생화학 실무 작업반 회의 (Working Group on Biochemical and Molecular Techniques and DNA Profiling in Particular, BMT)에서는 품종 구분에 있어 SSR 및 SNP 같은 공우성 마커를 이용한 품종 신규성 보완을 권고하였다 (UPOV-BMT, 2017).

분자 마커에는 restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSRs), single nucleotide polymorphisms (SNPs) 등이 있으며, 그 중 SSR은 핵, 엽록체 및 미토콘드리아 DNA에 1 bp - 6 bp의 염기서열이 반복적으로 분포하고 있다. SSR은 다형성과 재현성이 높고 하나의 마커에서도 다양한 대립 유전자를 확인할 수 있어 다양한 작물의 품종 구별, 유전적 다양성 분석, 그룹 간 구조 분석 등에 활용된다 (Sunnucks, 2000; Moisan-Thiery et al., 2005; Hamblin et al., 2007; Singh et al., 2013).

약용작물의 경우 더덕, 도라지, 참당귀, 황해쑥, 식량작물의 경우 벼, 옥수수, 원예작물의 경우 고추, 수박 등에서 SSR 마커가 개발되어 유전적 다양성 분석, 품종 구분, 집단 구조 분석에 활용되었다 (Kwon et al., 2005; Kwon et al., 2007; Pourabed et al., 2015; Kim et al., 2016; Um et al., 2016; Adu et al., 2019; Jeong et al., 2019; Shin et al., 2023).

단삼에서는 Conserved Region Amplification Polymorphism (CoRAP), Inter Simple Sequence Repeats (ISSR) 마커를 이용한 수집 자원의 유전적 다양성 평가, SSR 마커 기반 양적 형질 좌위 분석 (Quantitative Trait Loci, QTL) 등이 진행되었으나 중국 단삼 자원에 한정되어 있다 (Wang et al., 2009; Zhang et al., 2013; Feng et al., 2019). 또한, 최근까지 단삼의 유전체 기반 SSR 마커 개발은 이루어지지 않았으며, 국내 단삼 자원의 유전적 다양성 분석 및 품종 구분을 위한 SSR 마커 개발이 필요할 것이다.

본 연구에서는 단삼 유전체 기반 SSR 마커를 개발하여 국내 육성 품종 및 계통에 대한 유전적 다양성 평가 및 품종 구분을 진행하였으며, 개발된 마커는 향후 교배모본 선정, 품종 순도 검정, 품종 구분 등에 활용할 수 있을 것이다.

재료 및 방법
1. 실험재료 및 DNA 추출

본 실험에서는 농촌진흥청 국립원예특작과학원 약용작물과에서 육성하여 재배 중인 단삼 44 자원을 사용하였다 (Table 1).

Table 1. 
List of 44 S. miltiorrhiza accessions used in this study.
No. Sample ID Type No. Sample ID Type
1 Dasan Variety 23 Y-20-001-10 Line
2 Gosan Variety 24 Y-20-001-11 Line
3 Hongdan Variety 25 Y-MCD-001-1 Line
4 SM1 Line 26 Y-MCD-001-2 Line
5 SM7 Line 27 Y-MCD-001-3 Line
6 SM11 Line 28 Y-MCD-001-4 Line
7 SM12 Line 29 Y-MCD-001-5 Line
8 SM13 Line 30 Y-MCD-001-6 Line
9 Y-10-001-19 Line 31 Y-MCD-001-7 Line
10 Y-10-001-21 Line 32 Y-MCD-001-8 Line
11 Y-10-001-26 Line 33 Y-MCD-001-9 Line
12 Y-10-001-27 Line 34 Y-MCD-001-10 Line
13 Y-10-001-31 Line 35 Y-MCD-001-11 Line
14 Y-20-001-1 Line 36 Y-MCD-001-12 Line
15 Y-20-001-2 Line 37 Y-MCD-001-13 Line
16 Y-20-001-3 Line 38 Y-MCD-001-14 Line
17 Y-20-001-4 Line 39 Y-MCD-001-15 Line
18 Y-20-001-5 Line 40 Y-MCD-001-16 Line
19 Y-20-001-6 Line 41 Y-MCD-001-17 Line
20 Y-20-001-7 Line 42 Y-MCD-001-18 Line
21 Y-20-001-8 Line 43 Y-MCD-001-19 Line
22 Y-20-001-9 Line 44 Y-MCD-001-20 Line

DNA는 1년생 단삼의 어린잎을 액체질소와 막자사발을 사용하여 분쇄 후, DNeasy Plant Mini Kit (QIAGEN, Germany)의 protocol에 따라 추출하였다. 추출한 DNA는 1.5% agarosegel에 전기영동하여 DNA quality를 확인하고, NanoDrop One/OneC UV-Vis (Thermo fisher scientific Inc., Waltham, MA, USA)을 사용하여 농도 및 순도 측정 후 10 ng/㎕로 정량하여 사용하였다.

2. SSR 탐색 및 프라이머 제작

SSR 염기서열을 확보하기 위해 Novaseq 6000 플랫폼 (Illumina Inc., San Diego, CA, USA)을 이용하여 품종 ‘다산’, ‘고산’, ‘홍단’과 계통 ‘Y-10-001-26’, ‘Y-10-001-27’ 총 5자원을 whole genome resequencing 하였다. 분석된 read는 Trimmomatic (Version 0.39) 프로그램을 사용하여 trimming 작업 후 (Bolger et al., 2014), SOAPdenovo2 (Luo et al., 2012) 프로그램을 사용하여 샘플별 assembly를 진행하였다 (Fig. 1A).


Fig. 1.  Flow charts for development of SSR markers in S. miltiorrhiza.

(A) Assembly process of sequenced reads. (B) SSR mining process using in-silico programs.



각 샘플의 assembled contig에서 SSR motif를 탐색하기 위하여 MISA 프로그램을 사용하였다 (Thiel et al., 2003). Motif type에 따라 dinucleotide 6 번, trinucleotide 5 번, tetranucleotide 4 번, pentanucleotide부터 decanucleotide는 3번 이상 반복하는 것을 기준으로 하였다.

Primer 3 프로그램을 사용하여 ‘다산’에서 탐색된 SSR motif를 기준으로 프라이머를 제작하였다 (Untergasser et al., 2012). Bowtie1 (Langmead et al., 2009) 프로그램을 사용하여 각 샘플의 assembled contig에 프라이머를 in silico PCR한 후 예상 PCR product 크기를 계산하여 다형성 예측 프라이머를 선발하였다 (Fig. 1B).

3. PCR (Polymerase chain reaction) 및 genotyping

선발한 프라이머의 PCR 조건을 확립하기 위해 ‘다산’, ‘고산’, ‘Y-10-001-26’, ‘Y-10-001-27’ 4 자원을 이용하여 조건 실험을 진행하였다. 먼저, annealing 온도 55℃에서 PCR을 진행하여 1 개 - 2 개의 band를 보이는 프라이머는 annealing 온도를 55℃로 설정하였다. 증폭되지 않은 프라이머는 annealing 온도 52℃, multi band를 보인 프라이머는 annealing 온도 58℃에서 PCR을 진행하였다. Annealing 온도 조절 후 1개 - 2 개의 band를 나타내는 프라이머의 annealing 온도를 설정하였고, PCR 조건이 확립된 프라이머를 분석에 활용하였다.

PCR 반응액은 Excel TB 2 × Taq Premix with dye (Inclone, Yongin, Korea) 10 ㎕, DW 6 ㎕, forward/reverse primer (10 pmole/㎕) 각 1 ㎕를 혼합한 후 gDNA 2 ㎕를 추가하여 총 20 ㎕를 사용하였다. PCR은 T-100 Thermal-Cycler (BIO-RAD Inc., Hercules, CA, USA) 기기를 이용하여 95℃에서 5 분간 pre-denaturation 후, 95℃에서 20 초denaturation, 각 프라이머의 설정 온도 52℃, 55℃, 58℃에서 40 초 annealing, 72℃에서 45 초 extension 조건으로 총 38회 반복하였고, 마지막으로 72℃에서 5 분간 final extension을 진행하였다.

PCR 산물은 2.5% agarose gel에서 45 분 동안 100V로 전 기영동 후, Safe Gel Stain (Inclone, Yongin, Korea)으로 염색하여 Geldoc XR Imaging System (Bio-Rad Inc., Hercules, CA, USA)에서 밴드를 확인하였다.

유전자형 분석은 Fragment Analyzer Automated CESystem (Advanced Analytical Technologies Inc., Ames, IA, USA)을 사용하였고, PROSize 3.0 software (Advanced Analytical Technologies Inc., Ames, IA, USA)를 사용하여 증폭된 단편의 크기를 확인하였다.

4. 데이터 분석

마커에 대한 유전적 다형성은 PowerMarker software (Version 3.25)를 사용하여 major allele frequency (MAF), number of alleles (NA), observed heterozygosity (HO), polymorphic information content (PIC)를 분석하였다 (Liu and Muse, 2005).

군집 분석은 PowerMarker software (Version 3.25)의 SharedAllele distance method를 기반으로 자원 간 유전적 거리를 분석하였다 (Liu and Muse, 2005). 이후 MEGA5.2 (Arizona State University, Tempe, AZ, USA)를 사용하여 UPGMA (Unweighted Pair Group Method with Arithmathic Mean) 방법을 이용한 계통수 (phylogenetic tree)를 통해 군집을 나누었다 (Tamura et al., 2011).

단삼 자원 구분 및 품종 구분을 위한 최소 마커 수를 구하기 위하여 R studio ‘Poppr’ 패키지로 genotype accumulation curve를 사용하였다 (Kamvar et al., 2014). UPGMA 계통수를 통해 최소 마커를 사용하여 단삼 자원을 구분하였고, 이후 증폭된 allele 크기를 비교하여 품종을 구분하였다 (Tamura et al., 2011).

결과 및 고찰
1. 단삼 SSR 특성 및 프라이머 제작

단삼 (Salvia miltiorrhiza Bunge) 5 자원을 이용한 염기서열 분석 결과, 자원별 331,035,523 bp (Y-10-001-26)에서 354,981,350 bp (다산)로 총 1,714 Mb의 염기서열 데이터를 확보하였다. 자원별 contig의 수는 644,701 개 (Y-10-001-26) 에서 859,399 개 (다산)였으며, 최대 길이의 contig는 17,973 bp (홍단)에서 33,139 bp (Y-10-001-26)로 평균 23,050 bp였다 (Table 2).

Table 2. 
Assembly results of five S. miltiorrhiza accessions.
Sample Number of
contigs		 Contig length
(bp)		 Max length (bp)
Dasan 859,399 354,981,350 18,562
Gosan 849,832 353,159,125 21,410
Hongdan 784,401 334,086,130 17,973
Y-10-001-26 644,701 331,035,523 33,139
Y-10-001-27 769,730 341,254,596 24,169

품종 ‘다산’의 유전체에서 탐색된 SSR motif는 총 98,839개였으며, dinucleotide 53,668 개 (54.30%), trinucleotide 16,097 개 (16.29%), pentanucleotide 13,922 개 (14.09%), hexanucleotide 6,854 개 (6.93%), tetranucleotide 6,452 개(6.53%)가 전체의 98.13% 분포하였고, heptanucleotide 1,568개 (1.59%), octanucleotide 196 개 (0.20%), nonanucleotide 56 개 (0.06%), decanucleotide 26 개 (0.03%) 순으로 분포하였다 (Table 3).

Table 3. 
Distribution of identified and primer designed SSRs in the variety S. miltiorrhiza ‘Dasan’.
SSR motif Identified SSRs Primer designed SSRs
Di 53,668 (54.30%) 19,538 (53.87%)
Tri 16,097 (16.29%) 4,891 (13.49%)
Tetra 6,452 (6.53%) 2,367 (6.53%)
Penta 13,922 (14.09%) 5,766 (15.90%)
Hexa 6,854 (6.93%) 2,950 (8.13%)
Hepta 1,568 (1.59%) 588 (1.62%)
Octa 196 (0.20%) 128 (0.35%)
Nona 56 (0.06%) 30 (0.08%)
Deca 26 (0.03%) 10 (0.03%)
Total 98,839 (100.00%) 36,268 (100.00%)

탐색된 SSR 중 36,268 개 SSR motif에 대해 프라이머가 제작되었고, 그 분포를 motif type에 따라 분석하였다. Dinucleotide는 총 19,538 개로 TA 5,473 개 (28.01%), AT 4,627 개 (23.68%), TC 1,877 개 (9.61%), CT 1,721 개 (8.81%)의 순서로 분포하였다. Trinucleotide는 총 4,891 개로 AAT 468 개 (9.57%), TTA 367 개 (7.50%), ATT 357 개 (7.30%), TAA 297 개 (6.07%) 순으로 분포하였다. Tetranucleotide는 총 2,367 개로 AAAT 307 개 (12.97%), TTTA 217 개 (9.17%), ATTT 203 개 (8.58%), AATA 149 개 (6.29%)의 순서로 분포하였다. Pentanucleotide는 총 5,766 개로 AAAAT 468 개 (8.12%), ATTTT 273 개 (4.73%), TTTTA 174 개 (3.02%), TAAAA 154 개 (2.67%) 순으로 분포하였다. Hexanucleotide는 총 2,950 개로 AAAAAT 137 개 (4.63%), ATTTTT 113 개 (3.83%), AAAAAG 72 개 (2.44%), AAAATA 67 개 (2.27%)의 순서로 분포하였다. Heptanucleotide는 총 588 개로 TTTTTTC 16 개 (2.72%)가 가장 많았고, octanucleotide는 총 128 개로 ATATATAG 5 개 (0.78%)가 가장 많았다. Nonanucleotide는 30 개 motif type이 각각 1 개 (3.33%)씩, decanucleotide는 10 개 motif type이 각각 1 개 (10.00%)씩 분포하였다 (Table 4).

Table 4. 
SSR motif frequencies of primer designed SSRs in the variety S. miltiorrhiza ‘Dasan’.
SSR motif Primer designed SSRs SSR motif type Motif frequency in primer designed SSRs
Di 19,538 TA 5473 (28.01%)
AT 4627 (23.68%)
TC 1877 (9.61%)
CT 1721 (8.81%)
Tri 4,891 AAT 468 (9.57%)
TTA 367 (7.50%)
ATT 357 (7.30%)
TAA 297 (6.07%)
Tetra 2,367 AAAT 307 (12.97%)
TTTA 217 (9.17%)
ATTT 203 (8.58%)
AATA 149 (6.29%)
Penta 5,766 AAAAT 468 (8.12%)
ATTTT 273 (4.73%)
TTTTA 174 (3.02%)
TAAAA 154 (2.67%)
Hexa 2,950 AAAAAT 137 (4.63%)
ATTTTTT 113 (3.83%)
AAAAAG 72 (2.44%)
AAAATA 67 (2.27%)
Hepta 588 TTTTTTC 16 (2.72%)
Octa 128 ATATATAG 5 (3.91%)
Nona 30 30 types 1 (3.33%)
Deca 10 10 types 1 (10.00%)

다형성 마커를 찾기 위해 프라이머가 제작된 36,268 개의 SSR motif를 in silico PCR로 분석한 결과, 다형성이 예상되는 418 개의 프라이머를 확보하였고, 그 중에서 dinucleotide 34개, trinucleotide 12 개, tetranucleotide 2 개, pentanucleotide 1개, hexanucleotide 1 개를 임의로 선발하여 총 50 개의 프라이머를 합성하였다 (Table 5).

Table 5. 
Detected polymorphic SSRs in the five S. miltiorrhiza accessions by in-silico PCR.
SSR motif Expected polymorphic
SSRs		 Selected polymorphic
SSRs
Di 161 (38.52%) 34 (68.00%)
Tri 79 (18.90%) 12 (24.00%)
Tetra 35 (8.37%) 2 (4.00%)
Penta 80 (19.14%) 1 (2.00%)
Hexa 54 (12.92%) 1 (2.00%)
Hepta 9 (2.15%) -
Octa - -
Nona - -
Deca - -
Total 418 (100.00%) 50 (100.00%)

기존 연구에서, 유전체 분석을 통한 콩 (soybean), 감자 (Solanum tuberosum L.), 쓴메밀 ((Fagopyrum tataricum Gaertn.), 참깨 (Sesamum indicum) 등에서 탐색된 SSR은 dinucleotide와 trinucleotide가 70% 이상으로 가장 높은 비율을 보였다. SSR motif 유형은 AT, TA, ATT, AAT 등 AT motif가 가장 많이 분포하는 결과를 보였다 (Song et al., 2010; Wei et al., 2014; Jian et al., 2021; Hou et al., 2022).

본 연구에서 탐색된 SSR은 dinucleotide와 trinucleotide가 가장 높은 비율을 보였으며, SSR motif 유형은 AT motif의 비율이 높게 나타나 기존 연구 결과와 유사한 경향을 보였다. 이는 식물에서 AT motif가 가장 많이 관찰되며, GC motif 보다 AT motif의 비율이 높게 나타나는 쌍자엽 식물의 특징과 일치하였다 (Sonah et al., 2011).

다만, 염기서열 데이터 생성량 및 assembly 수준에 따라 SSR 분포 및 빈도가 달라질 수 있으며, 본 연구에서는 NGS 기반 assembly를 통해 다량의 염기서열 및 SSR 정보를 제공하여 향후 단삼 유전체 연구 및 육종 등에 활용할 수 있을 것이다 (Taheri et al., 2018).

2. 단삼 SSR 마커 다형성 분석

본 연구에서 개발된 SSR 마커를 유전적 다양성 분석, 집단구조 분석 등에 활용하기 위하여 다형성을 분석하였다. 선발한 50 개 프라이머 중 9 개를 제외한 41 개 프라이머에서 다형성이 확인되었다. 단삼 44 자원에 대한 41 개 SSR 마커의 유전적 다형성 분석 결과, MAF는 0.19 (SM-2391-3)에서 0.83 (SM-0217-7)으로 평균 0.47이었으며, NA는 2 개 (SM-1918-3)에서 17 개 (SM-0839-4)로 총 346 개로 나타났다. HO는 0 (SM-0189-1, SM-0247-4, SM-4415-5)에서 0.60 (SM-0134-1)으로 평균 0.22로 확인되었으며, PIC은 0.29 (SM-0217-7)에서 0.87 (SM-0818-5, SM-0839-4)로 평균 0.64로 나타났다 (Table 6).

Table 6. 
Genetic diversity index and primer information of 41 SSR markers for 44 S. miltiorrhiza accessions used in this study.
No. Marker Primer sequence Repeat motif Tm1) (℃) MAF2) NA3) HO4) PIC4)
1 SM-0134-1 F: ACTTCGAGGATCCAAGCTGC
R: GCTGGTCCATTGGGAGACAA		 (AC)6 55 0.29 9 0.60 0.77
2 SM-0051-9 F: TTGAACGGAGAAGAAGGGCC
R: CCTCCACCACTCAACCTCAC		 (AG)6 55 0.32 12 0.07 0.75
3 SM-0189-1 F: CCGTTCTGCGACATCGTTTC
R: CCCCTAGGCCGAGTTAACAA		 (AG)6 55 0.57 4 0.00 0.54
4 SM-2167-1 F: CATCACTGCTTTCCTGCTGC
R: GGGACAAAACGCATTTCTCCC		 (AT)6 55 0.20 9 0.16 0.82
5 SM-0217-7 F: CCAACAGCCCGACAACAAAG
R: TACCATGAGAGCCTCCTCCC		 (TG)6 55 0.83 5 0.18 0.29
6 SM-0688-3 F: CATGAAGAATGTGAGGCGCG
R: GAGTTCACCATCCCGACCAG		 (TG)6 55 0.40 11 0.36 0.73
7 SM-4222-2 F: TGATGAACCTCTGCGTTTCCA
R: TCGTGAGCTGATCATCCCAA		 (TG)6 55 0.34 15 0.39 0.82
8 SM-3860-3 F: GCACAGTGCTGTAAAGATGCT
R: TCCGCAGTTCTGTTGTCTCC		 (AC)7 55 0.39 12 0.43 0.72
9 SM-0818-5 F: GACTGACGCACGGATGAAGA
R: CCCTCCATAGACAGGGTTTTGA		 (AG)7 55 0.24 15 0.20 0.87
10 SM-0206-4 F: AAAATCACATCCCCCGCCAT
R: GTCCGGCTATTACTGGCTCC		 (TC)7 55 0.63 6 0.07 0.45
11 SM-0480-3 F: GTGTGTGTATGGGCCTTCGT
R: TTACCAGCAAGAGAACGCCA		 (TC)7 55 0.38 9 0.35 0.71
12 SM-3725-3 F: TTCCTGATGGCCGCTCTTAC
R: AGCCCCACACAAACCAAAGA		 (TC)7 55 0.44 11 0.14 0.72
13 SM-0247-4 F: CGGAGCAGAAAACTCGAAAACA
R: CGCTCTCGCTAATGGAGGAG		 (AG)8 55 0.57 7 0.00 0.55
14 SM-0646-8 F: CGTCAGCAGGTTCCCAATCT
R: AAGCAAAAGTTACGAGCGCG		 (AG)8 55 0.69 7 0.14 0.46
15 SM-3377-1 F: TTTTCCCTTCCAATGCCGGA
R: GCTCCACACACACTATCCCC		 (AG)8 58 0.36 9 0.32 0.78
16 SM-2391-3 F: GTGTGCAGAAGTTTGGTGTCC
R: TGTGTTATGACTCTCCCGCTC		 (GT)8 55 0.19 14 0.36 0.86
17 SM-0469-3 F: CGGGGTAGGTTTGCTGGAAT
R: TCCCTAAAGCCCCAAAGAGC		 (TC)8 55 0.35 8 0.23 0.75
18 SM-2366-2 F: TCGACTTAACCGCCATTGCT
R: CATTTGCATGTCGACACCCG		 (TC)8 55 0.40 11 0.34 0.73
19 SM-0315-3 F: CCCATACCACACACCACTCC
R: CGCTCGCTCTGTTATGGCTA		 (CA)9 55 0.65 6 0.41 0.52
20 SM-2091-2 F: TTTCCCATAGCACCACCACC
R: TTGGTGGGCTCAACAACGTA		 (CA)9 55 0.44 8 0.30 0.64
21 SM-2719-5 F: GATCGAAAATGGAACGGCGG
R: TCGAAGGTCATGAGGTTGCC		 (TC)9 55 0.36 9 0.19 0.76
22 SM-0839-4 F: CCGGCGGTTAATCAATTGCA
R: ATGTATCTCTGGTACGCGCG		 (AT)10 55 0.24 17 0.34 0.87
23 SM-0015-3 F: ACTCAGAAAAGGCGATGCGA
R: CGGATGCAGAGTCCTCTTCC		 (CT)10 55 0.53 9 0.25 0.65
24 SM-0507-4 F: GAGTGGGTTGACGTTCGTCT
R: ATGGAGTTTCGCCCTCATCG		 (CT)10 55 0.28 8 0.32 0.77
25 SM-0006-1 F: GGTTCTCGCGTTCTCACAA
R: CTGTTTTTGGACGAGCTCCG		 (TA)10 58 0.28 13 0.25 0.85
26 SM-0079-1 F: TGGATCTCGAGTCTCCAGTCT
R: AGGCGGAACATGTCAAGAGG		 (TC)10 55 0.60 5 0.27 0.52
27 SM-1375-5 F: TAGGTCTTCAGAGCGGTGGA
R: CATGCCCCTCGTCTCTTGTA		 (GA)11 55 0.49 9 0.05 0.67
28 SM-4415-5 F: TGCATCACATTAACAACATGAACA
R: TCGACTCACATAAACACTCCA		 (AAT)5 55 0.51 5 0.00 0.52
29 SM-2784-1 F: CGCACTGAATCAAGGCGTTT
R: ACATCATCACTCGGCCAAGG		 (GAT)5 55 0.60 7 0.25 0.57
30 SM-3833-4 F: AGTGCGCTGATAGAAACCGA
R: ATTGAAGGTGTGCGGGAGAG		 (TTA)5 55 0.40 11 0.15 0.76
31 SM-1066-8 F: ACAGTCTCCACAGCACAAGA
R: ACCCTCATAAATGCCGCACA		 (TTC)5 55 0.47 8 0.21 0.66
32 SM-2593-4 F: AGAGGGTGATTGATGGTGCG
R: ACACACTGCCCACGCATTTA		 (TTC)5 55 0.52 5 0.14 0.54
33 SM-1259-1 F: TCATTTGAGAGTCGCCCGTG
R: TTCGAGTCGACCGTTACGAG		 (TTG)5 55 0.53 4 0.24 0.48
34 SM-3215-1 F: TGACCCCAAGATCTTTACCGA
R: GCTGGATCGAGGCATTCAGA		 (AAG)6 55 0.48 6 0.14 0.56
35 SM-2113-5 F: CATCCTCTCCCTCCTTCCCA
R: GGCAGTGGACTCCTCATCTC		 (GAT)6 55 0.66 5 0.07 0.47
36 SM-4088-2 F: GGGGGCGCCACAATTACTAA
R: TGCAACATGAGATCAAACTCCA		 (TAA)6 58 0.40 12 0.14 0.73
37 SM-3706-2 F: TCTGACATTTGAGTGGCACTC
R: TGCATGCAACTCATCAAGGAG		 (TCT)6 52 0.41 5 0.18 0.65
38 SM-3268-6 F: CGTAGCTCAACACGGGAGAT
R: CAGAACCAAGGCCAATGCAC		 (GAG)7 55 0.72 5 0.11 0.40
39 SM-0008-6 F: ATAGCTGGCCTGCAAAGGTT
R: ACCGCATATGGCTTGGTTCA		 (TTAT)5 55 0.66 6 0.18 0.50
40 SM-0738-7 F: AAATAGCTTGGTGCCTGGGG
R: ACAGGTCATACCCGTAGCAA		 (TTTA)5 55 0.60 7 0.31 0.56
41 SM-1918-3 F: AGGGCGTTGTTGATTGTTGC
R: TGCTTTGGACGCTGATGACT		 (CCAAT)3 55 0.77 2 0.24 0.29
　 Mean 　 　 　 0.468 8.439 0.221 0.640
1)TM; Annealing temperature, 2)MAF; Major allele frequency, 3)NA; Number of alleles, 4)HO; Observed heterozygosity, 5)PIC; Polymorphism information content.

단삼과 동일한 샐비어속의 경우, 세이지 (S. officinalis L.) SSR 마커의 평균 PIC 0.84와 로즈마리 (S. rosemarinus Schleid.) SSR 마커의 평균 PIC 0.87과 비교하면, 본 연구에서 개발된 SSR 마커의 평균 PIC은 낮게 나타났다. 이는 세이지와 로즈마리는 여러 지역의 수집 자원을 이용하였으나, 본 연구에서는 육성 자원을 분석하였기 때문에 다형성 결과가 비교적 낮게 나타난 것으로 추정된다 (Radosavljević et al., 2012; Zigene et al, 2021). 다만, 일반적으로 야생종 및 재래종은 품종 및 육성계통에 비해 더 높은 유전적 다양성을 보이며, PIC가 0.5 이상이면 높은 수준의 다형성을 나타낸다고 한 보고에 따르면, 본 연구에서 개발한 단삼 SSR 마커는 높은 다형성을 보이는 것으로 나타났다 (Botstein et al., 1980; Ram et al., 2007; Min et al., 2010; Zhang et al., 2017).

현재 다양한 분자 마커를 활용한 유전적 다양성 연구가 진행되고 있다. 단삼에서는 RAPD, AFLP, ISSR, SRAP 마커를 이용한 유전적 다양성 분석 등 선행 연구가 진행되었다 (Guo et al, 1994; Wang et al, 2007; Zhang et al, 2013). 그러나, 높은 다형성, 재현성, multiallelic 등의 특성으로 유전적 다양성 분석 및 집단 구조 분석, 품종 구분 등 다양한 연구에 SSR 마커가 효율적이라고 보고되고 있다 (Powell et al., 1996; Belaj et al., 2003). 이에 본 연구에서 개발된 유전체 기반 SSR 마커는 핵심 집단 선발, 종 내 다양성 분석 및 종간 다양성 분석 등에 활용될 수 있을 것이다.

3. 단삼 유전자원 군집 분석

개발된 41 개 SSR 마커를 이용하여 단삼 44 자원에 대한 유전적 거리 기반 군집 분석 결과, 단삼 자원은 크게 3 개 Group으로 나뉘었다. Group Ⅰ은 17 자원 (38.64%)으로 품종 ‘고산’과 ‘홍단’이 포함되었으며, Group Ⅱ는 12 자원 (27.27%), Group Ⅲ은 15 자원 (34.09%)으로 품종 ‘다산’이 포함되었다.

각 Group 내에서 자원 간 유전적 거리를 비교한 결과, Group Ⅰ에서는 품종 ‘홍단’, 계통 ‘SM1’과 품종 ‘고산’이 가장 가까웠으며, Group Ⅱ에서는 각각 계통 ‘Y-MCD-001-6’, ‘Y-MCD-001-7’과 계통 ‘Y-MCD-001-17’, ‘Y-MCD-001-20’이 가장 가깝게 나타났고, Group Ⅲ에서는 계통 ‘Y-MCD-001-1’, ‘Y-MCD-001-2’와 품종 ‘다산’이 가장 가까웠다. 단삼 44 자원 중에서 다른 자원과 유전적 거리가 가장 먼 자원은 계통 ‘Y-20-001-7’과 ‘Y-MCD-001-18’, ‘Y-MCD-001-19’였으며, 품종 ‘홍단’, 계통 ‘SM1’과 품종 ‘고산’의 유전적 거리가 가장 가까웠다 (Fig. 2).


Fig. 2.  Phylogenetic tree based on genetic distance analysis using SharedAllele Distance method among 44 S. miltiorrhiza accessions.


단삼은 자원 간 유전적으로 가까운 것으로 나타났으며, 특히 신품종 ‘홍단’은 기존 품종 ‘고산’과 매우 가깝게 나타났다.

우리나라에는 S. miltiorrhiza 1 종이 분포하고 있으며 대한 약전에 단삼으로 등재되어 사용되고 있다 (MFDS, 2020; NIBR, 2023). 현재까지 단삼은 S. miltiorrhiza 1 종을 이용하여 품종 ‘다산’ 방임 수분 후 선발 및 농가 수집 자원 선발 등 제한적인 자원을 통해 육종되었기 때문에 유전적으로 가까울 수 있다 (KSVS, 2016; 2018). 수확량, 저항성, 품질 등을 목표로 한 품종 개량으로 인해 작물의 유전적 다양성이 낮아지는 결과를 가져왔으며, 토마토, 인삼, 장미 등에서도 품종 간 유전적 유사도가 높다고 보고한 바 있다 (Arunachalam, 1981; Kwon et al., 2006; Bang et al., 2013; Hong et al., 2013).

작물의 유전적 다양성이 낮아지게 되면 유전적 침식이 발생할 수 있고 이로 인해 유전적 취약성을 초래할 수 있다 (Charlesworth and Charlesworth, 1995; Tanksley and McCouch, 1997). 우리나라 단삼의 유전적 다양성을 높이기 위해서는 국내외에서 다양한 자원을 확보하여 유전자 pool을 높여야 할 것이며, 이를 통해 새로운 변이 창출 가능성을 높일 수 있는 다양한 계통을 생산할 수 있을 것이다 (Li and Nelson, 2001; Chung et al., 2009; Dempewolf et al., 2017). 이에 본 연구에서 개발한 SSR 마커를 이용한 군집 분석을 통해 단삼 자원의 다양성을 평가하고, 교배 조합 작성, 자원 선발 등을 통해 새로운 유전자원을 발굴하여 육종에 활용할 수 있을 것이다.

4. 단삼 유전자원 구분 및 품종 구분을 위한 최소 마커

단삼 유전자원을 구분하기 위하여 R studio의 poppr 패키지로 genotype accumulation curve를 사용하여 최소 마커를 선정한 결과, 41 개 SSR 마커 중 2 개 SSR 마커를 사용하여 단삼 자원을 구분할 수 있었다 (Fig. 3A). PIC와 NA가 높은 2 개 SSR 마커 (SM-0839-4, SM-0818-5)를 사용하였으며, 단삼 44 자원이 전부 구분되었다 (Fig. 3B).


Fig. 3.  The number of minimum markers using genotype accumulation curve to discriminate.

(A) S. miltiorrhiza accessions and (C) S. miltiorrhiza varieties. Phylogenetic trees illustrating discrimination of (B) 44 S. miltiorrhiza accessions using two markers. (SM-0818-5, SM-0839-4). and (D) three S. miltiorrhiza varieties using 18 markers. (amplified allele size; bp).



단삼 품종 구분에 효율적인 최소 마커 수를 구하기 위해 R studio의 poppr 패키지로 genotype accumulation curve를 사용한 결과, 1 개 SSR 마커를 사용하여 품종을 구분할 수 있었다 (Fig. 3C). 단삼 3 개 품종에 대한 유전형을 분석한 결과, 자원 구분에 활용한 2 개 SSR 마커를 포함한 총 18 개의 SSR 마커 (SM-0079-1, SM-3377-1, SM-0006-1, SM-2719-5, SM-0480-3, SM-0818-5, SM-0839-4, SM-2784-1, SM-2366-2, SM-0200-4, SM-2091-2, SM-0015-3, SM-2391-3, SM-2167-1, SM-3215-1, SM-0738-7, SM-3860-3, SM-2593-4)로 단삼 3 개 품종이 구분되었다 (Fig. 3D).

단삼 품종 구분의 경우 분석 대상이 3 개 품종에 불과하지만, 분석에 사용된 품종이 유전적으로 가까움에도 불구하고 개체 간 구분이 가능하였다. SSR 마커는 품종의 신규성, 구별성을 보다 정확하게 구분하는 기술로, 품종 등록 시 육성가의 권리보호에 기여할 수 있을 것이다 (Bang et al., 2011; Korir et al., 2013). 본 연구에서 개발한 SSR 마커를 이용하여 단삼 품종 구분, 품종 순도 검정 등에 활용할 수 있을 것이며, 추후 단삼 신품종과 수입 품종의 구분을 위해 추가적인 SSR 마커 개발이 필요할 것이다.

Acknowledgments

본 성과물은 농촌진흥청 연구사업(과제번호: RS-2022-RD010073) 및 2023년도 농촌진흥청 학·연협동연구과정 지원 사업에 의해 이루어진 결과로 이에 감사드립니다.

References
1. Adu GB, Awuku FJ, Amegbor IK, Haruna A, Manigben KA and Aboyadana PA. (2019). Genetic characterization and population structure of maize populations using SSR markers. Annals of Agricultural Sciences. 64:47-54.
2. Arunachalam V. (1981). Genetic distance in plant breeding. Indian Journal of Genetics and Plant Breeding. 41:226-236.
3. Bang KH, Chung JW, Kim YC, Jo IH, Kim JU, Shin MR, Hyun DY, Kim DH, Cha SW Kim KH, Moon JY, Noh BS and Kim HS. (2013). Analysis of genetic polymorphism of Korean ginseng cultivars and breeding lines using RAPD markers. Korean Journal of Medicinal Crop Science. 25:184-193.
4. Bang KH, Chung JW, Kim YC, Lee JW, Jo IH, Seo AY, Kim OT, Hyun DY, Kim DH and Cha SW. (2011). Development of SSR markers for identification of Korean ginseng(Panax ginseng C. A. Meyer) cultivars. Korean Journal of Medicinal Crop Science. 19:185-190.
5. Belaj A, Satovic Z, Cipriani G, Baldoni L, Testolin R, Rallo L and Trujillo I. (2003). Comparative study of the discriminating capacity of RAPD, AFLP and SSR markers and of their effectiveness in establishing genetic relationships in olive. Theoretical and Applied Genetics. 107:736-744.
6. Bolger AM, Lohse M and Usadel B. (2014). Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics. 30:2114-2120.
7. Botstein D, White RL, Skolnick M and Davis RW. (1980). Construction of a genetic linkage map in man using restriction fragment length polymorphisms. American Journal of Human Genetics. 32:314-331.
8. Buck M and Hamilton C. (2011). The Nagoya protocol on access to genetic resources and the fair and equitable sharing of benefits arising from their utilization to the convention on biological diversity. Review of European Community and International Environmental Law. 20:47-61.
9. Charlesworth D and Charlesworth B. (1995). Quantitative genetics in plants: The effect of the breeding system on genetic variability. Evolution. 49:911-920.
10. Chen Y and Nelson RL. (2004). Genetic variation and relationships among cultivated, wild, and semiwild soybean. Crop Science. 44:316-325.
11. Choi KJ and Kim CH. (2010). Impact of introduction of plant breeders' right. The Journal of Intellectual Property. 5:121-167.
12. Choi KJ. (2002). International union for the protection of new varieties of plants(UPOV) and its 1991 convention. Korean Journal of Horticultural Science and Technology. 20:151-159.
13. Chung JW, Lee GA, Lee SS, Bang KH, Park CB and Park YJ. (2009). Cultivar discrimination of Korean and Chinese Boxthorn(Lycium chinense Mill. and Lycium barbarum L.) using SSR markers. Korean Journal of Medicinal Crop Science. 17:445-451.
14. Dempewolf H, Baute G, Anderson J, Kilian B, Smith C and Guarino L. (2017). Past and future use of wild relatives in crop breeding. Crop Science. 57:1070-1082.
15. Feng YY, Guo LL, Jin H, Lin CC, Zhou CH, Fang XS, Wang JH and Song ZQ. (2019). Quantitative trait loci analysis of phenolic acids contents in Salvia miltiorrhiza based on genomic simple sequence repeat markers. Industrial Crops and Products. 133:365-372.
16. Guo B, Lin S, Feng Y and Zhao Y. (1994). Primary research on genetic relationship among main Populations of Salvia miltiorrhiza and genuineness of herb. Chinese Traditional and Herbal Drugs. 24:wpr-570785. https://pesquisa.bvsalud.org/portal/resource/pt/wpr-570785 (cited by 2023 Jun 6).
17. Hamblin MT, Warburton ML and Buckler ES. (2007). Empirical comparison of simple sequence repeats and single nucleotide polymorphisms in assessment of maize diversity and relatedness. PLoS ONE. 2:e1367. https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0001367 (cited by 2023 Jun 6).
18. Hong JH, Kwon YS, Suh JN and Choi KJ. (2013). Identification of Rose(Rosa x hybrida) varieties using simple sequence repeat(SSR) markers. Korean Journal of Breeding Science. 45:96-103.
19. Hou S, Ren X, Yang Y, Wang D, Du W, Wang X, Li H, Han Y, Liu L and Sun Z. (2022). Genome-wide development of polymorphic microsatellite markers and association analysis of major agronomic traits in core germplasm resources of tartary buckwheat. Frontiers in Plant Science. 13:819008. https://www.frontiersin.org/articles/10.3389/fpls.2022.819008/full (cited by 2023 July 24).
20. International Union for the Protection of New Varieties of Plants(UPOV). (2017). C/51/10 Progress report of the work of the technical committee, the technical working parties and working Group on biochemical and molecular techniques and DNA-profiling in particular. Geneva, Switzerland. C/38/10Add, Oct18. https://www.upov.int/meetings/en/doc_details.jsp?meeting_id=44153&doc_id=386156 (cited by 2023 May 7).
21. Jeong DH, Park YM, Kim KY, Park HW, Jeon KS, Kim MJ, Gil JS, Lee Y and Um Y. (2019). Genetic diversity of Angelica gigas Nakai collected in Korea using genome-wide SSR markers. Korean Journal of Medicinal Crop Science. 27:376-382.
22. Jian Y, Yan W, Xu J, Duan S, Li G and Jin L. (2021). Genome-wide simple sequence repeat markers in potato: Abundance, distribution, composition, and polymorphism. DNA Research. 28:dsab020. https://academic.oup.com/dnaresearch/article/28/6/dsab020/6381570?login=true (cited by 2023 July 24).
23. Kamvar ZN, Tabima JF and Grünwald NJ. (2014). Poppr: An R package for genetic analysis of populations with clonal, partially clonal, and/or sexual reproduction. PeerJ. 2:e281. https://peerj.com/articles/281/ (cited by 2023 May 22).
24. Kim S, Jeong JH, Chung H, Kim JH, Gil JS, Um Y, Kim OT, Kim TD, Kim YY, Lee DH, Kim HB and Lee Y. (2016). Simple sequence repeat marker development from Codonopsis lanceolata and genetic relation analysis. Journal of Plant Biotechnology. 43:181-188.
25. Korea seed and variety service(KSVS). (2016). Cultivar 'Dasan'. Gimcheon, Korea. http://www.seed.go.kr/seed/270/subview.do (cited by 2023 July 7).
26. Korea seed and variety service(KSVS). (2018). Cultivar 'Gosan'. Gimcheon, Korea. http://www.seed.go.kr/seed/270/subview.do (cited by 2023 July 7).
27. Korir NK, Han J, Shangguan L, Wang C, Kayesh E, Zhang Y and Fang J. (2013). Plant variety and cultivar identification: Advances and prospects. Critical Reviews in Biotechnology. 33:111-125.
28. Kwon YS, Lee JM, Yi GB, Yi SI, Kim KM, Soh EH, Bae KM, Park EK, Song IH and Kim BD. (2005). Use of SSR markers to complement tests of distinctiveness, uniformity, and stability(DUS) of pepper(Capsicum annuum L.) varieties. Molecules and Cells. 19:428-435.
29. Kwon YS, Park EK, Bae KM, Yi SI, Park SG and Cho IH. (2006). Use of simple sequence repeat(SSR) markers for variety identification of Tomato(Lycopersicon esculentum). Journal of Plant Biotechnology. 33:289-295.
30. Kwon YS, Park EK, Lee WS, Lee SI, Bae KM, An JS and Kim HY. (2007). Genetic assessment of Watermelon(Citrullus Lanatus) varieties using SSR markers developed from Cucurbit species. Genes and Genomics. 29:137-146.
31. Langmead B, Trapnell C, Pop M and Salzberg SL. (2009). Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology. 10:1-10.
32. Li Z and Nelson RL. (2001). Genetic diversity among soybean accessions from three countries measured by RAPDs. Crop Science. 41:1337-1347.
33. Liu K and Muse SV. (2005). PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics. 21:2128-2129.
34. Lu S. (2019). The Salvia miltiorrhiza genome. Springer International Publishing AG. Cham, Switzerland. p.1-15.
35. Luo R, Liu B, Xie Y, Li Z, Huang W, Yuan J, He G, Chen Y, Pan Q, Liu Y, Tang J, Wu G, Zhang H, Shi Y, Liu Y, Yu C, Wang B, Lu Y, Han C, Cheung DW, Yiu SM, Peng S, Xiaoqian Z, Liu G, Liao X, Li Y, Yang H, Wang J, Lam TW and Wang J. (2012). SOAPdenovo2: An empirically improved memory-efficient short-read de novo assembler. GigaScience. 1:2047-217X.
36. Min W, Run-zhi L, Wan-ming Y and Wei-jun D. (2010). Assessing the genetic diversity of cultivars and wild soybeans using SSR markers. African Journal of Biotechnology. 9:4857-4866.
37. Ministry of Agriculture, Food and Rural Affairs(MAFRA). (2020). 2019 an actual output of crop for a special crop for a special purpose. Ministry of Agriculture, Food and Rural Affairs. Sejong, Korea. p.36.
38. Ministry of Agriculture, Food and Rural Affairs(MAFRA). (2022). 2021 an actual output of crop for a special crop for a special purpose. Ministry of Agriculture, Food and Rural Affairs. Sejong, Korea. p.36.
39. Ministry of Food and Drug Safety(MFDS). (2020). The Korean Pharmacopoeia. Ministry of Food and Drug Safety. Cheongju, Korea. p.1348.
40. Moisan-Thiery M, Marhadour S, Kerlan MC, Dessenne N, Perramant M, Gokelaere T and Le Hingrat Y. (2005). Potato cultivar identification using simple sequence repeats markers(SSR). Potato Research. 48:191-200.
41. National Institute of Biological Resources(NIBR). (2023). Korea Biodiversity Information System. https://species.nibr.go.kr/index.do (cited by 2023 July 7).
42. Parida SK, Kalia SK, Kaul S, Dalal V, Hemaprabha G, Selvi A, Pandit A, Singh A, Gaikwad K, Sharma TR, Srivastava PS, Singh NK and Mohapatra T. (2009). Informative genomic microsatellite markers for efficient genotyping applications in sugarcane. Theoretical and Applied Genetics. 118:327-338.
43. Pourabed E, Noushabadi MRJ, Jamali SH, Alipour NM, Zareyan A and Sadeghi L. (2015). Identification and DUS testing of rice varieties through microsatellite markers. International Journal of Plant Genomics. 2015:965073. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4337753/ (cited by 2023 June 7).
44. Powell W, Morgante M, Andre C, Hanafey M, Vogel J, Tingey S and Rafalski A. (1996). The comparison of RFLP, RAPD, AFLP and SSR(microsatellite) markers for germplasm analysis. Molecular Breeding. 2:225-238.
45. Radosavljević I, Satovic Z, Jakse J, Javornik B, Greguraš D, Jug-Dujaković M and Liber Z. (2012). Development of new microsatellite markers for Salvia officinalis L. and its potential use in conservation-genetic studies of narrow endemic Salvia brachyodon Vandas. International Journal of Molecular Sciences. 13:12082-12093. https://www.mdpi.com/1422-0067/13/9/12082 (cited by 2023 June 7).
46. Ram SG, Thiruvengadam V and Vinod KK. (2007). Genetic diversity among cultivars, landraces and wild relatives of rice as revealed by microsatellite markers. Journal of Applied Genetics. 48:337-345.
47. Shin HR, Han JW, Lee JH, Ma KH, So YS, Jo IH and Chung JW. (2023). Development of genomic SSR markers and cultivar discrimination in Artemisia argyi. Korean Journal of Medicinal Crop Science. 31:116-124.
48. Singh N, Choudhury DR, Singh AK, Kumar S, Srinivasan K, Tyagi RK, Singh NK and Singh R. (2013). Comparison of SSR and SNP markers in estimation of genetic diversity and population structure of Indian rice varieties. PloS One. 8:e84136. https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0084136 (cited by 2023 Jun 7).
49. Smýkal P, Horáček J, Dostálová R and Hýbl M. (2008). Variety discrimination in pea(Pisum sativum L.) by molecular, biochemical and morphological markers. Journal of Applied Genetics. 49:155-166.
50. Sonah H, Deshmukh RK, Sharma A, Singh VP, Gupta DK, Gacche RN and Sharma TR. (2011). Genome-wide distribution and organization of microsatellites in plants: An insight into marker development in Brachypodium. Plos One. 6:e21298. https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0021298 (cited by 2023 July 12).
51. Song Q, Jia G, Zhu Y, Grant D, Nelson RT, Hwang EY, Hyten DL and Cregan PB. (2010). Abundance of SSR motifs and development of candidate polymorphic SSR markers(BARCSOYSSR_1.0) in soybean. Crop Science. 50:1950-1960.
52. Su CY, Ming QL, Rahman K, Han T and Qin LP. (2015). Salvia miltiorrhiza: Traditional medicinal uses, chemistry, and pharmacology. Chinese Journal of Natural Medicines. 13:163-182.
53. Sunnucks P. (2000). Efficient genetic markers for population biology. Trends in Ecology and Evolution. 15:199-203.
54. Taheri S, Lee Abdullah T, Yusop MR, Hanafi MM, Sahebi M, Azizi P and Shamshiri RR. (2018). Mining and development of novel SSR markers using next generation sequencing(NGS) data in plants. Molecules. 23:399. https://www.mdpi.com/1420-3049/23/2/399 (cited by 2023 July 24).
55. Tamura K, Dudley J, Nei M and Kumar S. (2011). MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance and maximum parsimony methods. Molecular Biology and Evolution. 28:2731-2739.
56. Tanksley SD and McCouch SR. (1997). Seed banks and molecular maps: Unlocking genetic potential from the wild. Science. 277:1063-1066.
57. Thiel T, Michalek W, Varshney R and Graner A. (2003). Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley(Hordeum vulgare L.). Theoretical and Applied Genetics. 106:411-422.
58. Um Y, Lee Y, Jin ML, Lee DY, Lee JW, Kim GS, Kim CK, Hong CP and Kim OT. (2016). Morphological characteristics and genetic diversity analysis of Platycodon grandiflorum(Jacq.) A. DC determined using SSR markers. Korean Journal of Medicinal Crop Science. 24:55-61.
59. Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M and Rozen SG. (2012). Primer3-new capabilities and interfaces. Nucleic Acids Research. 40:e115. https://academic.oup.com/nar/article/40/15/e115/1223759?login=true (cited by 2023 May 7).
60. Wang B, Zhang Y, Chen CB, Li XL, Chen RY and Chen L. (2007). Analysis on genetic diversity of different Salvia miltiorrhiza geographical populations in China. China Journal of Chinese Materia Medica. 32:1988-1991.
61. Wang Q, Zhang B and Lu Q. (2009). Conserved region amplification polymorphism(CoRAP), a novel marker technique for plant genotyping in Salvia miltiorrhiza. Plant Molecular Biology Reporter. 27:139-143.
62. Wei X, Wang L, Zhang Y, Qi X, Wang X, Ding X, Zhang J and Zhang X. (2014). Development of simple sequence repeat(SSR) markers of sesame(Sesamum indicum) from a genome survey. Molecules. 19:5150-5162. https://www.mdpi.com/1420-3049/19/4/5150 (cited by 2023 May 7).
63. Will M and Claßen-Bockhoff R. (2017). Time to split Salvia s.l.(Lamiaceae)-new insights from old world Salvia phylogeny. Molecular Phylogenetics and Evolution. 109:33-58.
64. Zhang H, Mittal N, Leamy LJ, Barazani O and Song BH. (2017). Back into the wild-apply untapped genetic diversity of wild relatives for crop improvement. Evolutionary Applications. 10:5-24.
65. Zhang XZ, Qian SS, Zhang YJ and Wang RQ. (2016). Salvia miltiorrhiza: A source for anti-Alzheimer's disease drugs. Pharmaceutical Biology. 54:18-24.
66. Zhang Y, Li X and Wang Z. (2013). Diversity evaluation of Salvia miltiorrhiza using ISSR markers. Biochemical Genetics. 51:707-721.
67. Zigene ZD, Asfaw BT and Bitima TD. (2021). Analysis of genetic diversity in rosemary(Salvia rosemarinus Schleid.) using SSR molecular marker for its management and sustainable use in Ethiopian genebank. Genetic Resources and Crop Evolution. 68:279-293.
 

Bisan-ro 92, Soie-myoen, Eumseong-gun, Chungbuk 27709, Korea
TEL : 043-871-5598 / FAX : 043-871-5599 / E-mail : medcrop@hanmail.net
Copyright © The Korean Society of Medical Crop Science. All rights reserved.