•

Journal Archive

Korean Journal of Medicinal Crop Science - Vol. 31 , No. 5
[Paper List] [Go to Volume List]

[ Article ]
Korean Journal of Medicinal Crop Science - Vol. 31, No. 5, pp.290-296
Abbreviation: Korean J. Medicinal Crop Sci
ISSN: 1225-9306 (Print) 2288-0186 (Online)
Print publication date 31 Oct 2023
Received 18 Aug 2023 Revised 25 Oct 2023 Accepted 25 Oct 2023
DOI: https://doi.org/10.7783/KJMCS.2023.31.5.290

영지버섯과 아까시흰구멍버섯의 판별을 위한 미토콘드리아 유전체 기반 InDel 마커 개발
안화용# ㆍ 구현조# ㆍ 김은경 ㆍ 정지란 ㆍ 나경주†
1서울대학교 농생명과학공동기기원 유전체분석센터 책임연구원
2서울대학교 농생명과학공동기기원 유전체분석센터 선임연구원
3서울대학교 농생명과학공동기기원 유전체분석센터 선임연구원
4서울대학교 농생명과학공동기기원 유전체분석센터 선임분석원
5서울대학교 농생명과학공동기기원 유전체분석센터 센터장

Development of Mitocondrial Genome-based InDel Markers to Distinguish between Ganoderma lucidum and Perenniporia fraxinea
Hwa Yong An# ㆍ Hyun Jo Koo# ㆍ Eun Kyoung Kim ㆍ Ji Ran Jeong ㆍ Gyoung Ju Nah†
1Principal Researcher, Genome Analysis Center, National Instrumentation Center for Environmental Management, Seoul National University, Seoul 08826, Korea
2Senior researcher, Genome Analysis Center, National Instrumentation Center for Environmental Management, Seoul National University, Seoul 08826, Korea
3Senior researcher, Genome Analysis Center, National Instrumentation Center for Environmental Management, Seoul National University, Seoul 08826, Korea
4Senior Analyst, Genome Analysis Center, National Instrumentation Center for Environmental Management, Seoul National University, Seoul 08826, Korea
5Center Director, Genome Analysis Center, National Instrumentation Center for Environmental Management, Seoul National University, Seoul 08826, Korea
Correspondence to : †(Phone) +82-2-880-4971 (E-mail) gnah.nicem@snu.ac.kr

#Hwa Yong An and Hyun Jo Koo are contrituted equally to this paper




This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Funding Information ▼
ABSTRACT
Background

Ganoderma lucidum and Perenniporia fraxinea are morphologically similar, making them difficult to distinguish when cut into pieces or powdered. Ganoderma lucidum is a more effective medicinal mushroom than P. fraxinea, but it is expensive, so there is a strong possibility that similar shaped mushrooms are mixed and sold together. Therefore, molecular biological markers that can differentiate G. lucidum from P. fraxinea are needed.

Methods and Results

We selected two polymorphic insertion-deletion (InDel) sites and one polymorphic InDel site from the cox1 and rnl genes within the mitochondrial DNA, respectively, and designed primers using flanking sequences that surrounded these polymorphic sites. We performed a polymerase chain reaction (PCR) to validate these markers. Three InDel markers were developed to differentiate between G. lucidum and P. fraxinea: GlPf_INDEL01, GlPf_INDEL02, and GlPf_INDEL04.

Conclusions

The three InDel markers developed in this study combined with a simple PCR analysis easily distinguished G. lucidum from P. fraxinea.

KeyWords: Ganoderma lucidum, Perenniporia fraxinea, Mitochondrial Genome, DNA Marker
서 언

영지버섯의 학명인 Ganoderma lucidum (Curtis) P. Karst.는 1881년 Petter Adolf Karsten에 의해 영국의 자료에 기초하여 명명되었다. G. lucidum은 동아프리카, 오세아니아, 북미, 남미, 아시아 (중국, 일본, 한국), 유럽을 포함한 전 세계적으로 광범위하게 분포하고 있는 버섯이다 (Kwon et al., 2019).

이 버섯은 민주름버섯목 (Aphillophorales), 구멍장이 버섯과 (Polyporaceae), 영지속 (Ganoderma)에 속하는 버섯으로 미국에서는 9 종, 일본에서는 5 종, 대만에서는 13 종, 중국에서는 64 종, 국내에서는 4 종이 보고되어 있고 (Yu et al., 2017), 한국에서는 “mushroom of immortality”의 뜻으로 ‘Yeongji’, 일본에서는 “spiritual potency”의 뜻으로 ‘Reishi’ 그리고 중국에서는 “divine mushroom”의 뜻으로 ‘Lingzhi’로 불리고 있다 (Kim et al., 2019; Ekiz et al., 2023).

일반적으로 영지버섯은 1년생 버섯으로 형태는 계통에 따라 다양하다. 조직은 코르크질 같고 표면은 니스를 칠한 것 같은 광택이 있으며 주로 활엽수 고사목과 그루터기에 자생하고 북반구 온대 이북에 광범위하게 분포하고 있다.

영지버섯은 중국, 일본, 그리고 한국과 같은 동아시아 국가들에서 수천 년 동안 전통적인 의학에서 사용되어 왔다(Kwon et al., 2016). 영지버섯은 혈장 내의 항산화 활성을 증가시키는 것으로 보고되었다 (Copot and Tanase, 2017; Seo et al., 2017). 또한 영지버섯은 우리나라 한방에서 몸과 마음을 안정시키고 장부에 에너지를 보충해주며 소화기를 건강하게 해주고, 가래 및 천식 제거와 같은 호흡기질환, 불면증, 신경쇠약, 혈압강하, 이뇨 등에 효과가 있는 약용버섯으로써 이용되고 있다 (Yu et al., 2017). 그뿐만 아니라 항암, 항균, 항바이러스, 항간염, 항보충 활성, 항섬유화 활성, 면역 조절활성 및 심혈관 효과와 같은 많은 약리학적 활성의 효과가 보고되었다.

(Hong and Jung, 2004; Wachte-Galor et al., 2005; Kim et al., 2019; Si et al., 2019; Ekiz et al., 2023).

아까시흰구멍버섯 (아까시재목버섯, Perenniporia fraxinea)은 약용버섯으로 담자균문 (Basidiomycota), 주름버섯강 (Agaricomycetes), 구멍장이버섯목 (Polyporales), 구멍장이버섯과 (Polyporaceae), 흰구멍버섯속 (Perenniporia)에 속하는 버섯으로 주로 아까시나무에서 많이 발생하기 때문에 ‘아까시흰구멍버섯’으로 불리며, 장수버섯, 아까시영지, 아까시재목버섯 등으로 불리기도 한다.

형태적으로 영지버섯과 비슷하지만 기부 (stipe)가 없는 것이 특징이다. 우리나라에서는 주로 아까시나무를 기주로 발생하며, 이외에도 벚나무, 졸참나무, 사과나무, 들나무 등과 같이 다양한 활엽수의 생목 그루터기에 자생하는 1년생 백색 부후성 버섯이다 (Kong et al., 2005).

아까시흰구멍버섯 또한 영지버섯의 효능처럼 면역 활성 (Cho et al., 1995a, 1995b; Bae et al., 1996), 항암 (Yoon et al., 1998), 항혈전, 항산화 (Park et al., 1998) 작용 등에 효과가 입증되면서 관심이 높아지는 버섯 중의 하나이나 암을 유발시키는 아질산염 소거능, 면역기능을 활성화시켜주는 역할을 하는 베타글루칸 함량 그리고 총 폴리페놀 및 플라보노이드 함량 등의 항산화 활성이 영지버섯에는 미치지 못한다 (An et al., 2021).

영지버섯은 한국, 중국, 일본 등에서 인기가 높은 건강식품 또는 약용으로 상품화되어 판매되고 있지만 다른 종과 섞어 판매하는 경우 특히 분말 형태일 경우 품종판별에 더 큰 어려움이 있어 이를 구별할 수 있는 DNA marker가 필요하다. 또한 영지버섯은 아까시흰구멍버섯보다 의료용으로 그 효과는 높으나 가격이 비싸다. 이로 인하여 영지버섯보다 가격 면에서 저렴하면서 형태학적으로 비슷한 아까시흰구멍버섯으로 오남용하는 경우가 생길 수 있다. 하지만 영지버섯과 비슷한 아까시흰구멍버섯의 구별을 위한 분자생물학적인 marker 개발은 이루어지지 않고 있는 실정이다.

Ganoderma 속의 마커개발에 관한 보고로서 Zhou 등 (2008)이 G. lucidum, G. sinense 및 G. tsuga에서 약리학적 기능을 가지는 3 종의 의료용 버섯을 다른 관련 종과 구별하기 위한 마커를 fungal immunomodulatory protein (FIP) 유전자의 염기서열을 기반으로 개발한 보고가 있다. 또한 Sun 등 (2006)과 Su 등 (2008)은 Ganoderma strains을 동정하기 위해 PCR-based sequence-related amplified polymorphism (SRAP) 마커를 개발한 보고가 있다.

본 연구에서 개발된 마커는 미토콘드리아 염기서열 기반 DNA 다중 공우성 마커 (muiltiple co-dominant marker)를 기반으로 개발되었다. 미토콘드리아 염기서열 기반 바코드 마커는 오랫동안 법의학에 기여해 왔다. 미토콘드리아 DNA는 분해 (미토콘드리아의 이중 막으로 인한 것일 수 있음)로부터 보호되고, 감수분열이나 유전자 재조합이 거의 일어나지 않아 여러 세대에 걸쳐 안정적이며, 핵 DNA보다 높은 복제 수를 가진다 (McClean and Hanson, 1986; Jo et al., 2013; Kim et al., 2023). 이러한 특성들로 인하여 mucormycetes에서 진단 마커 개발에 있어 미토콘드리아 유전자를 장려해 왔다 (Caramalho et al., 2019).

Hebert 등 (2003)은 동물 종의 분류를 위한 표준화된 단일분자 마커로서 cytochrome c oxidase subunit 1 mitochondrialgene (cox1 or COI)을 사용하는 새로운 종 식별 시스템인 DNA 바코드를 제안하였다. 또한 Rodrigues 등 (2017)도 미토콘드리아 DNA 내 cox1 (또는 COI) 유전자를 사용하는 DNA 바코드 시스템이 척추동물 및 무척추동물 종을 구별하는데 매우 효율적이며 Trypanosoma cruzi와 밀접하게 관련된 다른 종들과의 식별을 위한 마커로써 cox1의 적합성을 조사한 결과를 발표하였다.

특히 본 연구에서는 영지버섯 (G. lingzhi)과 아까시흰구멍버섯 (P. fraxinea) 내 각각의 미토콘드리아 genome 염기서열을 바탕으로 PCR을 이용하여 쉽게 검출이 가능하며 전기영동을 이용하여 증폭 산물의 크기를 비교해 간단히 확인할 수 있는 장점을 가진 insertion-deletion (InDel) 마커 3 개의 개발을 수행하였다. 이 마커들은 공우성 (co-dominant) 마커이므로 PCR 후 band 크기 차이로 판별이 가능하다. 또한 1 개가 아닌 3 개의 마커 조합을 사용함으로써 판별의 정확성을 높이고자 하였다. Next-generation sequencing (NGS) 기반 다중 DNA 마커를 신속하게 개발함으로써 영지버섯 (G. lucidum)과 아까시흰구멍버섯 (P. fraxinea)의 객관적이고 정확도 높은 판별이 가능할 것으로 판단된다.

재료 및 방법
1. 연구재료

본 실험에서 마커 선별을 위해 사용된 재료인 영지버섯 (G. lingzhi: KMCC05111)과 아까시흰구멍버섯 (P. fraxinea: KMCC05094)은 국립원예특작과학원으로부터 분양받았다.

종 판별을 위해 개발된 3 개의 InDel 마커가 실질적으로 판별에 사용 가능한지 여부를 검증하기 위해 영지버섯 (G. lucidum)과 아까시흰구멍버섯 (P. fraxinea) 시료들을 국립생물자원관과 국립원예특작과학원으로부터 분양받아 사용하였다(Table 1).

Table 1. 
Ganoderma lucidum and Perenniporia fraxinea strains used in this study.
No. Strain Species Source Sample
type
1 NIBRGR0000176318 Ganoderma
lucidum		 NIBR1) T3)
2 NIBRGR0000195266 NIBR T
3 NIBRGR0000195277 NIBR T
4 NIBRGR0000195008 NIBR T
5 NIBRFGC000143394 NIBR CC4)
6 KMCC05363 NIHHS2) CC
7 KMCC05187 NIHHS CC
8 KMCC05107 NIHHS CC
9 KMCC05095 NIHHS CC
10 KMCC05091 NIHHS CC
11 NIBRGR0000058956 Perenniporia
fraxinea		 NIHHS T
12 NIBRGR0000165633 NIBR T
13 NIBRGR0000176622 NIBR T
14 NIBRGR0000195237 NIBR T
15 NIBRFGC000143389 NIBR CC
16 KMCC05191 NIHHS CC
17 KMCC05094 NIHHS CC
18 KMCC04875 NIHHS CC
19 KMCC04902 NIHHS CC
20 KMCC04640 NIHHS CC
1)NIBR; National Institute of Biological Resources, Incheon, Korea, 2)National Institute of Horticultural and Herbal Science, Rural Development Administration, Jeonju, Korea. 3)T; tissue, 4)CC; cultured cell.

2. 마커선별

마커 선별을 위해 National Center for Biotechnology Information (NCBI, Bethesda, MD, USA)에 등록된 영지버섯의 미토콘드리아 유전체 정보 (accesion No. OR286997.1)와 아까시흰구멍버섯의 미토콘드리아 유전체 정보 (https://doi.org/10.6084/m9.figshare.24406327.v2)의 유전자 서열들을 수집하였다. 영지버섯과 아까시흰구멍버섯의 이종상동성 유전자들의 서열을 정렬하여, PCR을 하였을 때 젤에서 구분이 잘 될 정도의 차이가 있는 산물을 생산할 수 있는 구간을 설정하여 프라이머를 제작하였다. 이렇게 제작된 프라이머를 이용하여 PCR을 수행한 후 예상과 동일한 PCR 산물을 생산하는 프라이머쌍을 마커로 선별하였다.

3. Genomic DNA 추출 및 polymerase chain reaction

두 기관으로부터 분양받은 버섯 시료는 액체질소를 이용하여 균일하게 분쇄한 후 GeneAll사 (Seoul, Korea)의 GeneAll® ExgeneTM Plant SV kit를 이용하여 genomic DNA를 추출하였다. 추출된 genomic DNA를 주형으로 하여 개발된 3 종의 InDel 마커를 이용하여 PCR을 수행하였다 (Table 2).

Table 2. 
Information of the developed Indel marker.
Marker name Primer sequences (5'-3') Amplicon size (bp) Gl1)/Pf2)
GlPf_INDEL01 F3): ACTAAGCCTACTTAAAGGTAGGACA 187/216
R4): TAAAGCAGGCATACTTTTATCCCT
GlPf_INDEL02 F: CCTATGTTTGGTATTGTAAAATCTCCT 270/306
R: GCAATTCACCCAATTTACTAATGGT
GlPf_INDEL04 F: CGTCTTTGATAAAGTAGCAAAGTACAT 251/304
R: CGTATCTGTTCGACTTCTAAGTCT
1)Gl; Ganoderma lingzhi, 2)Pf: Perenniporia fraxinea, 3)F: forward primer, 4)R: reverse primer.

PCR을 위한 혼합 용액은 BIOFACT 사 (Daejeon, Korea)의 BioFACT F-Star Taq polymerase kit를 이용하였고 구성은 5 ng/㎕ - 10 ng/㎕로 희석된 DNA, 10 µM forward primer 1 ㎕, 10 µM reverse primer 1 ㎕, 10 × Taq reaction buffer 2 ㎕, 10 mM dNTP Mix. 0.4 ㎕, Taq polymerase (5 U/㎕) 0.1 ㎕ 그리고 3차 증류수로 최종 20 ㎕가 되도록 맞춰주었다.

PCR은 Applied Biosystems 2720 Thermal Cycler (Thermo Fisher Scientific Inc., Waltham, MA, USA)를 이용하여 조건은 95℃에서 pre-denaturation 2 분을 수행한 후, 95℃에서 denaturation 30 초, annealing 온도는 모든 primer set가 52℃로 동일하게 30 초간 적용되었고 extension은 72℃에서 30초간 반응시켰으며 이를 총 32 cycles 반복하였다. 그리고 72℃에서 final extension을 5 분간 실시하였다.

이때 마커 개발에 이용된 영지버섯 (KMCC05111)과 아까시 흰구멍버섯 (KMCC05094) DNA를 positive control DNA로 사용하여 각각 P1, P2로 명명하였으며, negative control은 멸균된 3차 증류수를 사용하였다.

4. 전기영동

각 10 종의 영지버섯과 아까시흰구멍버섯 genomic DNA를 주형으로 하여 개발된 마커의 검증을 위해 증폭된 PCR product는 전기영동을 이용하여 확인하였다.

전기영동에 사용할 gel은 2% - 3% agarose로 만들었으며 SYBR safe DNA gel stain (10,000 ×, Invitrogen, Carlsbad, CA, USA)을 사용하여 DNA를 염색하였다. 1 × TAE 용액에 agarose gel을 넣고 PCR product를 2 ㎕씩 분주하였고, 각 agarose gel의 첫 lane에는 100 bp ladder marker (MGmed, Seoul, Korea)를 5 ㎕씩 넣은 후 전기영동을 수행하였다.

Gel DocTM XR+ System (Bio-Rad Inc., Hercules, CA, USA)를 이용하여 PCR product를 시각화시켜 분석하였다.

결과 및 고찰
1. NGS 분석을 통한 영지버섯과 아까시흰구멍버섯의 미토콘드리아 기반 InDel 마커 개발

영지버섯 (G. lucidum)과 아까시흰구멍버섯 (P. fraxinea)의 염기서열 중 atp6, cob, cox1, cox2, cox3, nad1, nad2, nad4, nad5, rnl, rns 그리고 rps3는 미토콘드리아 유전체로부터 추출되었다.

완성된 미토콘드리아 유전체 서열로부터 gff3 파일의 유전자 정보를 이용하여 EMBOSS의 seqret 명령어로 해당 유전자서열들을 추출하였다.

마커 선별을 위해 두 버섯 종의 각 유전자 세트를 multiple alignment using fast fourier transform (MAFFT)를 사용하여 정렬하고 비교하였다 (Katoh et al., 2019). 마커 후보는 PCR 을 하였을 때 증폭된 길이가 두 종에서 달라지는 프라이머 세트를 선택하였고, 그 결과 cox1과 rnl에서 187 bp와 334 bp 사이의 증폭된 길이를 가지는 마커들을 찾을 수 있었다. 최종적으로 cox1과 rnl 유전자에서 각각 두 개와 한 개의 마커를 선별하였다 (Fig. 1).


Fig. 1.  Nucleotide sequences alignment of G. lingzhi (Gl) and P. fraxinea (Pf) marker regions by multiple alignment using fast fourier transform (MAFFT).

(A) INDEL01 sequences, (B) INDEL02 sequences, (C) INDEL04 sequences. Primer binding regions were indicated with underline.



개발된 InDel 마커들은 각각 GlPf_INDEL01, GlPf_INDEL02, GlPf_INDEL04로 명명하였다. GlPf_INDEL01과 GlPf_INDEL02는 cox1 유전자 위의 마커이며, GlPf_INDEL04는 rnl 유전자 서열상의 변이정보에 기반하여 설계된 마커이다.

2. 개발된 InDel 마커 검증

개발된 3 개의 InDel 마커 검증을 위하여 해당 마커 primer를 사용하여 G. lucidum 10 종 그리고 P. fraxinea 10종으로부터 DNA를 각각 추출하여 PCR을 통해 유전자를 증폭 후 2.0 % - 3.0 % agarose gel로 전기영동 하였다. 영지버섯과 아까시흰구멍버섯의 종 구별은 유전자 증폭 산물의 크기 차이로 확인할 수 있었다.

Negative control은 3차 증류수를 이용하였고, positive control 1 (P1)과 2 (P2)는 각각 마커 개발에 사용된 영지버섯과 아까시흰구멍버섯을 사용하였으며 검증 결과는 Fig. 2에 나타내었다.


Fig. 2.  Results of PCR using the developed Indel Markers.

(A); GlPf_INDEL01, (B); GlPf_INDEL02, (C); GlPf_INDEL04. N; negative control (ddH2O), P1; G. lingzhi (NIHHS strain No. KMCC05111), P2; P. fraxinea (NIHHS strain No. KMCC05094).



마커 GlPf_INDEL01 검증 결과, 10 개의 영지버섯 시료 (PCR product 크기, 약 187 bp)와 10 개의 아까시흰구멍버섯시료 (PCR product 크기, 약 216 bp)에서 각각의 positive control P1과 P2의 PCR product에 부합하는 결과를 보였다 (Fig. 2A).

GlPf_INDEL02 마커는 10 개의 영지버섯 시료와 10 개의 아까시흰구멍버섯 시료에서 각각 약 270 bp와 306 bp 크기의 PCR product가 증폭되었고 이는 각각의 positive control P1과 P2의 PCR product에 부합하는 결과를 보였다 (Fig. 2B). 뿐만 아니라 개발된 마커 GlPf_INDEL04를 검증한 결과 positive control P1과 P2의 PCR product 크기 약 251 bp와 304 bp에 부합하는 결과를 보였다 (Fig. 2C).

미토콘드리아 DNA 내 cox1 유전자 기반 2 개의 마커들은 영지버섯과 아까시흰구멍버섯 속에 대한 구별이 가능함을 알 수 있었다. 그뿐만 아니라 rnl 유전자 기반 1 개의 마커 역시 영지버섯과 아까시흰구멍버섯 속을 구별할 수 있었다.

본 연구에서 개발된 마커를 통하여 영지버섯과 아까지흰구멍버섯 간의 분자적 판별이 가능할 것으로 보이며, 이 두 속의 형태적 유사성에 의해 오용 및 혼용되는 것을 방지하는데 큰 도움이 될 것으로 기대된다.

Acknowledgments

본 연구는 식품의약안전처 부정·불량식품의 스마트 감시 시스템 및 판별기술 고도화 사업(과제번호: 22193생산안471-3)의 지원에 의하여 이루어진 결과로 이에 감사드립니다. 또한 마커 검증에 필요한 시료를 보내주신 국립원예특작과학원과 국립생물자원관의 관계자분께 감사드립니다.

References
1. An GH, Han JG, Kim OT and Cho JH. (2021). Evaluation of biological activities of extracts of Korean wild mushrooms. Journal of Mushroom. 19:41-50.
2. Bae MJ, Park MH and Lee JS. (1996). Studies on immunomodulating function of components separated from higher fungi. The Korean Journal of Mycology. 24:142-148.
3. Caramalho R, Madl L, Rosam K, Rambach G, Speth C, Pallua J, Larentis T, Araujo R, Alastruey-Izquierdo A, Lass-Flörl C and Lackner M. (2019). Evaluation of a novel mitochondrial Pan-Mucorales marker for the detection, identification, quantification, and growth stage determination of Mucormycetes. Journal of Fungi. 5:98. https://www.mdpi.com/2309-608X/5/4/98 (cited by 2023 Aug 18).
4. Cho SM, Lee JH, Han SB, Kim HM, Yu SH and Yoo ID. (1995a). Immuno-stimulating polysaccharides from the fruiting bodies of Fomitella fraxinea(I)-Characterization of polysaccharides extracted with neutral sodium chloride solution. The Korean Journal of Mycology. 23:332-339.
5. Cho SM, Lee JH, Han SB, Kim HM, Yu SH and Yoo ID. (1995b). Immuno-stimulating polysaccharides from the fruiting bodies of Fomitella fraxinea (II)-Isolation and charaterization of hot-water extracted polysaccharides. The Korean Journal of Mycology. 23:340-347.
6. Copot O and Tănase C. (2017). Maxent modelling of the potential distribution of Ganoderma lucidum in North-Eastern region of Romania. Journal of Plant Development. 24:133-143.
7. Ekiz E, Oz E, El-Aty AMA, Proestos C, Brennan C, Zeng M, Tomasevic I, Elobeid T, Çadirci K, Bayrak M and Oz F. (2023). Exploring the potential medicinal benefits of Ganoderma lucidum: From metabolic disorders to coronavirus infections. Foods. 12:1512. https://www.mdpi.com/2304-8158/12/7/1512 (cited by 2023 Aug 18).
8. Hebert PDN, Cywinska A, Ball SL, deWaard JR. (2003). Biological identifications through DNA barcodes. Proceedings of the Royal Society B. 270:313-321.
9. Hong SG and Jung HS. (2004). Phylogenetic analysis of Ganoderma based on nearly complete mitochondrial small-subunit ribosomal DNA sequences. Mycologia. 96:742-755.
10. Jo IH, Bang KH, Kim YC, Kim JU, Shin MR, Moon JY, Noh BS, Hyun DY, Kim DH, Kim Dh, Cha SW and Kim HS. (2013). Analysis of mitochondrial DNA sequence and molecular marker development for identification of Panax species. Korean Journal of Medicinal Crop Science. 21:91-96.
11. Katoh K, Rozewicki J and Yamada KD. (2019). MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics. 20:1160-1166.
12. Kim HJ, Koo MH, Lee JH, Suh SS and Youn UJ. (2019). Secondary metabolites isolated from Ganoderma lucidum and their anti-inflammatory activity. Korean Journal of Pharmacognosy. 50:232-238.
13. Kim JH, Jeong YH, Lee MS, Kim M, Jo N, Gil J, Koo SC and Lee Y. (2023). Development of InDel markers to distinguish among Codonopsis species. Korean Journal of Medicinal Crop Science. 31:12-17.
14. Kong WS, Yoo YB, Jhune CS, You CH, Cho YH and Kim KH. (2005). A new functional mushroom cultivated variety “Jangsaeng” of Fomitella fraxinea. Jounal of Mushroom Science and Production. 3:129-132.
15. Kwon OC, Lee CS and Park YJ. (2019). SNP and SCAR markers for specific discrimination of antler-shaped Ganoderma lucidum. Microorganisms. 7:12. https://www.mdpi.com/2076-2607/7/1/12 (cited by 2023 Aug 18).
16. Kwon OC, Park YJ, Kim HI, Kong WS, Cho JH and Lee CS. (2016). Taxonomic position and species identity of the cultivated Yeongji 'Ganoderma lucidum' in Korea. Mycobiology. 44:1-6.
17. McClean PE and Hanson MR. (1986). Mitochondrial DNA sequence divergence among Lycopersicon and related Solanum species. Genetics. 3:649-667.
18. Park SS, Yu KH and Min TJ. (1998). Antioxidant activities of extracts from fruiting bodies of mushrooms. The Korean Journal of Mycology. 26:69-77.
19. Rodrigues MS, Morell KA and Jansen AM. (2017). Cytochrome c oxidase subunit 1 gene as a DNA barcode for discriminating Trypanosoma cruzi DTUs and closely related species. Parasites and Vectors. 10:488. https://parasitesandvectors.biomedcentral.com/articles/10.1186/s13071-017-2457-1 (cited by 2023 Aug 18).
20. Seo KH, Kim YH, Lee YM, Ghosh M, Park KM, Park DH, Kim JH and Lim BO. (2017). Evaluation of anti-oxidant and anti-inflammatory activities of Ganoderma lucidum cultured on hulled barley. Korean Journal of Medicinal Crop Science. 25:29-36.
21. Si J, Meng G, Wu Y, Ma HF, Cui BK and Dai YC. (2019). Medium composition optimization, structural characterization, and antioxidant activity of exopolysaccharides from the medicinal mushroom Ganoderma lingzhi. International Journal of Biological Macromolecules. 124:1186-1196.
22. Su H, Wang L, Ge Y, Feng E, Sun J and Liu L. (2008). Development of strain-specific SCAR markers for authentication of Ganoderma lucidum. World Journal of Microbiology and Biotechnology. 24:1223-1226.
23. Sun SJ, Gao W, Lin SQ, Zhu J, Xie BG and Lin ZB. (2006). Analysis of genetic diversity in Ganoderma population with a novel molecular marker SRAP. Applied Microbiology and Biotechnology. 72:537-543.
24. Wachtel-Galor S, Choi SW and Benzie IFF. (2005). Effect of Ganoderma lucidum on human DNA is dose dependent and mediated by hydrogen peroxide. Redox Report. 10:145-149.
25. Yoon SH, Lim JH, Kim YS, Kim CH, Jo JH and Hwang YS. (1998). Pharmacological effects of proteoglycans extracted from fruiting bodies of Fomitella fraxinea. The Korean Journal of Mycology. 26:511-518.
26. Yu YJ, Choi KH, Seo SY, Kang CH, Lee GK and Kim HJ. (2017). Comparison of growth characteristics of Ganoderma lucidum based on media and environmental conditions. Journal of Mushroom. 15:104-110.
27. Zhou X, Li Q, Yin Y, Chen Y and Lin J. (2008). Identification of medicinal Ganoderma species based on PCR with specific primers and PCR-RFLP. Planta Medica. 74:197-200.
 

Bisan-ro 92, Soie-myoen, Eumseong-gun, Chungbuk 27709, Korea
TEL : 043-871-5598 / FAX : 043-871-5599 / E-mail : medcrop@hanmail.net
Copyright © The Korean Society of Medical Crop Science. All rights reserved.